Our goal here is to go over designing guides for a tiling screen on positive genes. We’ll design CRISPR guide libraries for the top genes in the screen. First we’ll go over how to do one gene and then extend the method to other genes.

Several studies have shown improved interference and activation with FANTOM5 annotated TSS’s. We shall do the same. TSS information was downloaded from http://biomart.gsc.riken.jp/ and lifted over to mm10 using the UCSC liftover tool (https://genome.ucsc.edu/cgi-bin/hgLiftOver).

setwd("~/sgRNA/sgRNAdesign/")
genes = scan("~/sgRNA/Yanxia/genes4tilingscreen.txt", what = character())
FANTOM5mm10TSSannotation = read.table(file = "~/sgRNA/sgRNAdesign/mm10TSSliftover.bed")
head(FANTOM5mm10TSSannotation)
##      V1        V2        V3                           V4  V5 V6        V7
## 1 chr10 100589202 100589203      p2@4930430F08Rik,0.3007  55  - 100589202
## 2 chr10 100589205 100589269      p1@4930430F08Rik,0.3053   0  - 100589205
## 3 chr10 100592365 100592382      p1@1700017N19Rik,0.1939  -3  + 100592365
## 4 chr10 100592386 100592406      p2@1700017N19Rik,0.1988   0  + 100592386
## 5 chr10  10343097  10343101 p1@ENSMUST00000118589,0.0800 -13  +  10343097
## 6 chr10 101681605 101681621            p12@Mgat4c,0.3624 -19  + 101681605
##          V8          V9
## 1 100589203  60,179,113
## 2 100589269  60,179,113
## 3 100592382 211,211,211
## 4 100592406 211,211,211
## 5  10343101 211,211,211
## 6 101681621  60,179,113
Top2TSSs = c()
for(gene in genes){
  Top2TSSs = rbind(Top2TSSs, FANTOM5mm10TSSannotation[grep(paste0("p1@", gene, ","), FANTOM5mm10TSSannotation[,4]),])
  Top2TSSs = rbind(Top2TSSs, FANTOM5mm10TSSannotation[grep(paste0("p2@", gene, ","), FANTOM5mm10TSSannotation[,4]),])
}
Top2TSSs
##           V1        V2        V3                         V4   V5 V6
## 23490  chr15  54745902  54745916              p1@Nov,0.2919  -11  +
## 23489  chr15  54745870  54745881              p2@Nov,0.2772  -46  +
## 15554  chr12  86421628  86421662            p1@Esrrb,0.5901    0  +
## 15569  chr12  86470131  86470150            p2@Esrrb,0.3256   14  +
## 26717  chr16  23988625  23988641             p1@Bcl6,0.3561  -13  -
## 26716  chr16  23988600  23988607             p2@Bcl6,0.3050    4  -
## 138196  chr7  30636514  30636529             p1@Etv2,0.1369 -225  -
## 11368  chr11  84525514  84525542             p1@Lhx1,0.2494    0  -
## 101016 chr11  84525894  84525930             p2@Lhx1,0.2707 -360  -
## 2093   chr10  57486354  57486414             p1@Hsf2,0.4737    0  +
## 2094   chr10  57486418  57486454             p2@Hsf2,0.5200   33  +
## 54772   chr3  34649987  34650005             p1@Sox2,0.4826    0  +
## 54773   chr3  34650024  34650050             p2@Sox2,0.4802   -4  +
## 89595   chr9  55541190  55541209             p1@Isl2,0.4408    0  +
## 89593   chr9  55538635  55538676             p2@Isl2,0.1039    0  +
## 3715   chr10  81559447  81559498              p1@Aes,0.4399    0  +
## 3716   chr10  81559524  81559583              p2@Aes,0.4529    0  +
## 1511   chr10  30842765  30842791             p1@Hey2,0.5586    0  -
## 1513   chr10  30842811  30842831             p2@Hey2,0.5308  -10  -
## 72993   chr6  43309549  43309552            p1@Nobox,0.2041    1  -
## 83229   chr8  12395603  12395621             p1@Sox1,0.2398   84  +
## 140181  chr8  12395874  12395885             p2@Sox1,0.1326  355  +
## 113450 chr18  11052644  11052661            p1@Gata6,0.4626  134  +
## 33421  chr18  11052487  11052510            p2@Gata6,0.5117    0  +
## 29910  chr17  27728937  27728956            p1@Spdef,0.1132    0  -
## 111472 chr17  27729074  27729086            p2@Spdef,0.1740 -123  -
## 22639  chr15 102954474 102954495           p1@Hoxc11,0.4722  -30  +
## 22640  chr15 102954510 102954521           p2@Hoxc11,0.4106   -4  +
## 31078  chr17  35506052  35506069           p1@Pou5f1,0.3172   13  +
## 31077  chr17  35506028  35506049           p2@Pou5f1,0.3152    0  +
## 65220   chr5 123394782 123394826            p1@Mlxip,0.3923    0  +
## 65219   chr5 123394770 123394781            p2@Mlxip,0.3918  -16  +
## 73754   chr6  64729118  64729132            p1@Atoh1,0.3346  -13  +
## 73756   chr6  64729241  64729254            p2@Atoh1,0.3880   95  +
## 31893  chr17  47737036  47737107             p1@Tfeb,0.3986    0  +
## 112581 chr17  47737174  47737207             p2@Tfeb,0.3822  137  +
## 94378   chrX   7967817   7967875            p1@Gata1,0.5548   -2  -
## 94377   chrX   7967802   7967812            p2@Gata1,0.4441    2  -
## 40561   chr1 167689552 167689563            p1@Lmx1a,0.5086    0  +
## 40562   chr1 167689565 167689577            p2@Lmx1a,0.5453    7  +
## 22284  chr14  99298652  99298715             p1@Klf5,0.3062    0  +
## 107327 chr14  99298945  99298989             p2@Klf5,0.1920  254  +
## 21407  chr14  63245219  63245265            p1@Gata4,0.3098    0  -
## 21412  chr14  63271654  63271679            p2@Gata4,0.5574   12  -
## 85405   chr8  72319053  72319071             p1@Klf2,0.2649    0  +
## 141319  chr8  72318893  72318915             p2@Klf2,0.2366 -117  +
## 38846   chr1 118627943 118627951          p1@Tfcp2l1,0.3550    0  +
## 38847   chr1 118627986 118628014          p2@Tfcp2l1,0.4221   41  +
## 62572   chr4  55532465  55532485             p1@Klf4,0.3020    0  -
## 129031  chr4  55532179  55532238             p2@Klf4,0.1941  214  -
## 70482   chr6 122707592 122707608 p1@Nanog,p1@Nanogpd,0.2468    0  +
## 70483   chr6 122707646 122707655 p2@Nanog,p2@Nanogpd,0.2636   53  +
##               V7        V8          V9
## 23490   54745902  54745916  60,179,113
## 23489   54745870  54745881  60,179,113
## 15554   86421628  86421662  60,179,113
## 15569   86470131  86470150  60,179,113
## 26717   23988625  23988641  60,179,113
## 26716   23988600  23988607  60,179,113
## 138196  30636514  30636529 211,211,211
## 11368   84525514  84525542  60,179,113
## 101016  84525894  84525930  60,179,113
## 2093    57486354  57486414  60,179,113
## 2094    57486418  57486454  60,179,113
## 54772   34649987  34650005  60,179,113
## 54773   34650024  34650050  60,179,113
## 89595   55541190  55541209  60,179,113
## 89593   55538635  55538676 211,211,211
## 3715    81559447  81559498  60,179,113
## 3716    81559524  81559583  60,179,113
## 1511    30842765  30842791  60,179,113
## 1513    30842811  30842831  60,179,113
## 72993   43309549  43309552 211,211,211
## 83229   12395603  12395621  60,179,113
## 140181  12395874  12395885 211,211,211
## 113450  11052644  11052661  60,179,113
## 33421   11052487  11052510  60,179,113
## 29910   27728937  27728956 211,211,211
## 111472  27729074  27729086 211,211,211
## 22639  102954474 102954495  60,179,113
## 22640  102954510 102954521  60,179,113
## 31078   35506052  35506069  60,179,113
## 31077   35506028  35506049  60,179,113
## 65220  123394782 123394826  60,179,113
## 65219  123394770 123394781  60,179,113
## 73754   64729118  64729132  60,179,113
## 73756   64729241  64729254  60,179,113
## 31893   47737036  47737107  60,179,113
## 112581  47737174  47737207  60,179,113
## 94378    7967817   7967875  60,179,113
## 94377    7967802   7967812  60,179,113
## 40561  167689552 167689563  60,179,113
## 40562  167689565 167689577  60,179,113
## 22284   99298652  99298715  60,179,113
## 107327  99298945  99298989 211,211,211
## 21407   63245219  63245265  60,179,113
## 21412   63271654  63271679  60,179,113
## 85405   72319053  72319071  60,179,113
## 141319  72318893  72318915  60,179,113
## 38846  118627943 118627951  60,179,113
## 38847  118627986 118628014  60,179,113
## 62572   55532465  55532485  60,179,113
## 129031  55532179  55532238 211,211,211
## 70482  122707592 122707608  60,179,113
## 70483  122707646 122707655  60,179,113
Top2TSSs = data.frame( chr = Top2TSSs[,1], TSS = apply(Top2TSSs[,c(2, 3, 6)], 1, function(x) if(x[3] == "+"){return(x[1])} else{return(x[2])}), strand = sapply(Top2TSSs[,6], function(x) if(x == "+"){return(1)} else{ return(-1)} ), 
                       gene = sapply(Top2TSSs[,4], function(x) sub(".*@", "", gsub("\\,.*","", x))))
Top2TSSs$TSS = as.numeric(levels(Top2TSSs$TSS))[Top2TSSs$TSS]
chr = Top2TSSs$chr[-which(duplicated(Top2TSSs$gene))]
strand = Top2TSSs$strand[-which(duplicated(Top2TSSs$gene))]
genes = Top2TSSs$gene[-which(duplicated(Top2TSSs$gene))]
start = rep(0, times = length(genes))
end = rep(0, times = length(genes))
l = 35000
for(i in 1:length(genes)){
  if(strand[i] == 1){
    start[i] = max(Top2TSSs$TSS[which(Top2TSSs$gene == genes[i])]) + 500
    end[i] = start[i] - l
  }
  else{
    start[i] = min(Top2TSSs$TSS[which(Top2TSSs$gene == genes[i])]) - 500
    end[i] = start[i] + l
  }
}

target.regions = data.frame(chr = chr, 
                            strand = sapply(strand, function(x) if(x == 1){return("+")} else{return("-")}),
                            gene = genes,
                            start = start,
                            end = end)
target.regions
##      chr strand    gene     start       end
## 1  chr15      +     Nov  54746402  54711402
## 2  chr12      +   Esrrb  86470631  86435631
## 3  chr16      -    Bcl6  23988107  24023107
## 4   chr7      -    Etv2  30636029  30671029
## 5  chr11      -    Lhx1  84525042  84560042
## 6  chr10      +    Hsf2  57486918  57451918
## 7   chr3      +    Sox2  34650524  34615524
## 8   chr9      +    Isl2  55541690  55506690
## 9  chr10      +     Aes  81560024  81525024
## 10 chr10      -    Hey2  30842291  30877291
## 11  chr6      -   Nobox  43309052  43344052
## 12  chr8      +    Sox1  12396374  12361374
## 13 chr18      +   Gata6  11053144  11018144
## 14 chr17      -   Spdef  27728456  27763456
## 15 chr15      +  Hoxc11 102955010 102920010
## 16 chr17      +  Pou5f1  35506552  35471552
## 17  chr5      +   Mlxip 123395282 123360282
## 18  chr6      +   Atoh1  64729741  64694741
## 19 chr17      +    Tfeb  47737674  47702674
## 20  chrX      -   Gata1   7967312   8002312
## 21  chr1      +   Lmx1a 167690065 167655065
## 22 chr14      +    Klf5  99299445  99264445
## 23 chr14      -   Gata4  63244765  63279765
## 24  chr8      +    Klf2  72319553  72284553
## 25  chr1      + Tfcp2l1 118628486 118593486
## 26  chr4      -    Klf4  55531738  55566738
## 27  chr6      +   Nanog 122708146 122673146
target.regions$start[which(target.regions$gene == "Esrrb")] = min(Top2TSSs$TSS[which(Top2TSSs$gene == "Esrrb")]) - l
target.regions$end[which(target.regions$gene == "Esrrb")] = max(Top2TSSs$TSS[which(Top2TSSs$gene == "Esrrb")])
target.regions$start[which(target.regions$gene == "Gata4")] = min(Top2TSSs$TSS[which(Top2TSSs$gene == "Gata4")])
target.regions$end[which(target.regions$gene == "Gata4")] = max(Top2TSSs$TSS[which(Top2TSSs$gene == "Gata4")]) + l
  
target.regions
##      chr strand    gene     start       end
## 1  chr15      +     Nov  54746402  54711402
## 2  chr12      +   Esrrb  86386628  86470131
## 3  chr16      -    Bcl6  23988107  24023107
## 4   chr7      -    Etv2  30636029  30671029
## 5  chr11      -    Lhx1  84525042  84560042
## 6  chr10      +    Hsf2  57486918  57451918
## 7   chr3      +    Sox2  34650524  34615524
## 8   chr9      +    Isl2  55541690  55506690
## 9  chr10      +     Aes  81560024  81525024
## 10 chr10      -    Hey2  30842291  30877291
## 11  chr6      -   Nobox  43309052  43344052
## 12  chr8      +    Sox1  12396374  12361374
## 13 chr18      +   Gata6  11053144  11018144
## 14 chr17      -   Spdef  27728456  27763456
## 15 chr15      +  Hoxc11 102955010 102920010
## 16 chr17      +  Pou5f1  35506552  35471552
## 17  chr5      +   Mlxip 123395282 123360282
## 18  chr6      +   Atoh1  64729741  64694741
## 19 chr17      +    Tfeb  47737674  47702674
## 20  chrX      -   Gata1   7967312   8002312
## 21  chr1      +   Lmx1a 167690065 167655065
## 22 chr14      +    Klf5  99299445  99264445
## 23 chr14      -   Gata4  63245265  63306679
## 24  chr8      +    Klf2  72319553  72284553
## 25  chr1      + Tfcp2l1 118628486 118593486
## 26  chr4      -    Klf4  55531738  55566738
## 27  chr6      +   Nanog 122708146 122673146
target.regions = data.frame(chr = target.regions$chr, strand = target.regions$strand, gene = target.regions$gene, start = apply(target.regions[ ,c("start", "end")], 1, min), end = apply(target.regions[ ,c("start", "end")], 1, max)) 
target.regions
##      chr strand    gene     start       end
## 1  chr15      +     Nov  54711402  54746402
## 2  chr12      +   Esrrb  86386628  86470131
## 3  chr16      -    Bcl6  23988107  24023107
## 4   chr7      -    Etv2  30636029  30671029
## 5  chr11      -    Lhx1  84525042  84560042
## 6  chr10      +    Hsf2  57451918  57486918
## 7   chr3      +    Sox2  34615524  34650524
## 8   chr9      +    Isl2  55506690  55541690
## 9  chr10      +     Aes  81525024  81560024
## 10 chr10      -    Hey2  30842291  30877291
## 11  chr6      -   Nobox  43309052  43344052
## 12  chr8      +    Sox1  12361374  12396374
## 13 chr18      +   Gata6  11018144  11053144
## 14 chr17      -   Spdef  27728456  27763456
## 15 chr15      +  Hoxc11 102920010 102955010
## 16 chr17      +  Pou5f1  35471552  35506552
## 17  chr5      +   Mlxip 123360282 123395282
## 18  chr6      +   Atoh1  64694741  64729741
## 19 chr17      +    Tfeb  47702674  47737674
## 20  chrX      -   Gata1   7967312   8002312
## 21  chr1      +   Lmx1a 167655065 167690065
## 22 chr14      +    Klf5  99264445  99299445
## 23 chr14      -   Gata4  63245265  63306679
## 24  chr8      +    Klf2  72284553  72319553
## 25  chr1      + Tfcp2l1 118593486 118628486
## 26  chr4      -    Klf4  55531738  55566738
## 27  chr6      +   Nanog 122673146 122708146

We’ll take a look at these in the genome browser.

Nov

Nov promoter

Nov promoter

This promoter looks very safe to target.

Esrrb

Esrrb promoter

Esrrb promoter

Safe to target.

Bcl6

Bcl6 promoter

Bcl6 promoter

Safe to target.

Etv2

Etv2 promoter

Etv2 promoter

This one is problematic, but not fully. Rbm42 and Haus5 run on the opposite strand, so we can probably target up to the TTS of these genes (30650317 and 30664994, respectively).

Lhx1

Lhx1 promoter

Lhx1 promoter

There is a lncRNA on the opposite strand (Lhx1os with TSS 84525660). If we target further upstream of this, we should be fine. We should also check the distribution of the guides to ensure that the effect is not due to Lhx1os.

Hsf2

Hsf2 promoter

Hsf2 promoter

Again, we have the same issue. We have to target further upstream to the TSS of 4930467K11Rik (57,486,351).

Sox2

Sox2 promoter

Sox2 promoter

Again a lncRNA is nearby, but this time on the same strand as the gene. We can target downstream of the TSS of Sox2ot (34,638,174) to ensure we are targetting Sox2.

Isl2

Isl2 promoter

Isl2 promoter

There is a gene in the opposite direction of Isl2, Etfa (TSS: 55,512,243). We will have to target about 5kb in the opposite direction to ensure we’re not targetting Etfa.

Aes

Aes promoter

Aes promoter

Again, there’s a gene in the opposite direction, Gna11 (TSS: 81,545,190). We’ll have to do the same as above.

Hey2

Hey2 promoter

Hey2 promoter

This gene looks safe to target.

Nobox

Nobox promoter

Nobox promoter

This gene looks safe to target.

Sox1

Sox1 promoter

Sox1 promoter

There is a predicted gene with a TSS upstream of the TSS, but I’m not sure how much we have to do about this.

Gata6

Gata6 promoter

Gata6 promoter

There are lncRNAs in the opposite direction that we may have to worry about. 1010001N08Rik with TSS at 11,052,567.

Spdef

Spdef promoter

Spdef promoter

There is a gene nearby, but it runs in the same direction as Spdef, so I don’t think there’s much we have to worry about as long as we don’t target in the gene (D17Wsu92e with TSS 27,751,232).

Hoxc11

Hoxc11 promoter

Hoxc11 promoter

There a whole mess here. If we target Hoxc11, we might also target Hotair. I don’t know if we should even include this gene.

Pou5f1

Pou5f1 promoter

Pou5f1 promoter

The only gene nearby is Tcf19, but this runs in the opposite direction so I don’t think we have to worry about this.

Mlxip

Mlxip promoter

Mlxip promoter

There is a gene running in the opposite direction Bcl7a with TTS 123,374,992.

Atoh1

Atoh1 promoter

Atoh1 promoter

This gene looks fine.

Tfeb

Tfeb promoter

Tfeb promoter

This gene looks problematic. The promoter for Pgc (TSS: 47,734,482) essentially overlaps with Tfeb. This gene will have to be verified.

Gata1

Gata1 promoter

Gata1 promoter

This gene looks good.

Lmx1a

Lmx1a promoter

Lmx1a promoter

This gene looks good.

Klf5

Klf5 promoter

Klf5 promoter

This gene looks good.

Gata4

Gata4 promoter

Gata4 promoter

This gene looks good.

Klf2

Klf2 promoter

Klf2 promoter

There is a pseudogene in the opposite direction that we may have to worry about. Gm10282 has a TSS at 72,305,260, so we will have to limit ourselves to about 5kb away from this.

Tfcp2l1

Tfcp2l1 promoter

Tfcp2l1 promoter

Again a problem here. We will have to limit ourselves to the TTS of Clasp1 (118,612,678).

Klf4

Klf4 promoter

Klf4 promoter

There is a predicted gene about 20Kb from the TSS of Klf4. We should be relatively safe, but to be sure we can target up to 5kb from the TSS of Gm12511 (55,563,265).

Nanog

Nanog promoter

Nanog promoter

This gene is safe.

modifying the target regions accordingly

target.regions$start[which(target.regions$gene == "Lhx1")] = max(c(84525660 + 500, target.regions$start[which(target.regions$gene == "Lhx1")]))  # avoid lncRNA on opposite strand
target.regions$end[which(target.regions$gene == "Etv2")] = min(c(target.regions$end[which(target.regions$gene == "Etv2")], 30650317 - 500, 30664994 - 500))  # avoid end of genes on same strand
target.regions$end[which(target.regions$gene == "Hsf2")] = min(c(target.regions$end[which(target.regions$gene == "Hsf2")], 57486351 - 500)) # avoid lncRNA on opposite strand
target.regions$start[which(target.regions$gene == "Sox2")] = max(c(target.regions$start[which(target.regions$gene == "Sox2")], 34638174 + 500)) # avoid lncRNA upstream on same strand
target.regions$start[which(target.regions$gene == "Isl2")] = target.regions$end[which(target.regions$gene == "Isl2")] - 5000  # avoid gene upstream on opposite strand
target.regions$start[which(target.regions$gene == "Aes")] = target.regions$end[which(target.regions$gene == "Aes")] - 5000  # avoid genes upstream on opposite strand
target.regions = target.regions[-which(target.regions$gene == "Gata6"), ] # Gata6 is a problem
target.regions$end[which(target.regions$gene == "Spdef")] = min(c(target.regions$end[which(target.regions$gene == "Spdef")], 27751232 - 500))  #there is predicted gene upstream of Spdef
target.regions = target.regions[-which(target.regions$gene == "Hoxc11"), ] # Hoxc11 is a problem
target.regions$start[which(target.regions$gene == "Mlxip")] = max(c(target.regions$start[which(target.regions$gene == "Mlxip")], 123374992 + 500))  # gene upstream of Mlxip
target.regions = target.regions[-which(target.regions$gene == "Tfeb"), ] # Tfeb is a problem
target.regions$start[which(target.regions$gene == "Klf2")] = max(c(target.regions$start[which(target.regions$gene == "Klf2")], 72305260 + 5000))
target.regions$start[which(target.regions$gene == "Tfcp2l1")] = max(c(target.regions$start[which(target.regions$gene == "Tfcp2l1")], 118612678))
target.regions$end[which(target.regions$gene == "Klf4")] = min(c(target.regions$end[which(target.regions$gene == "Klf4")], 55563265 - 5000))
target.regions$gene = factor(target.regions$gene, levels = unique(target.regions$gene))
target.regions
##      chr strand    gene     start       end
## 1  chr15      +     Nov  54711402  54746402
## 2  chr12      +   Esrrb  86386628  86470131
## 3  chr16      -    Bcl6  23988107  24023107
## 4   chr7      -    Etv2  30636029  30649817
## 5  chr11      -    Lhx1  84526160  84560042
## 6  chr10      +    Hsf2  57451918  57485851
## 7   chr3      +    Sox2  34638674  34650524
## 8   chr9      +    Isl2  55536690  55541690
## 9  chr10      +     Aes  81555024  81560024
## 10 chr10      -    Hey2  30842291  30877291
## 11  chr6      -   Nobox  43309052  43344052
## 12  chr8      +    Sox1  12361374  12396374
## 14 chr17      -   Spdef  27728456  27750732
## 16 chr17      +  Pou5f1  35471552  35506552
## 17  chr5      +   Mlxip 123375492 123395282
## 18  chr6      +   Atoh1  64694741  64729741
## 20  chrX      -   Gata1   7967312   8002312
## 21  chr1      +   Lmx1a 167655065 167690065
## 22 chr14      +    Klf5  99264445  99299445
## 23 chr14      -   Gata4  63245265  63306679
## 24  chr8      +    Klf2  72310260  72319553
## 25  chr1      + Tfcp2l1 118612678 118628486
## 26  chr4      -    Klf4  55531738  55558265
## 27  chr6      +   Nanog 122673146 122708146

Overlap with enhancer regions

mouse_enhancer_mESC = read.table(file = "mouse_enhancer_mESC.txt", col.names = c("chr", "start", "end", "cell.Type", "strand"))
hist(mouse_enhancer_mESC$end - mouse_enhancer_mESC$start, breaks = 100)

library(GenomicRanges)
## Loading required package: stats4
## Loading required package: BiocGenerics
## Loading required package: parallel
## 
## Attaching package: 'BiocGenerics'
## The following objects are masked from 'package:parallel':
## 
##     clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
##     clusterExport, clusterMap, parApply, parCapply, parLapply,
##     parLapplyLB, parRapply, parSapply, parSapplyLB
## The following objects are masked from 'package:stats':
## 
##     IQR, mad, sd, var, xtabs
## The following objects are masked from 'package:base':
## 
##     anyDuplicated, append, as.data.frame, cbind, colMeans,
##     colnames, colSums, do.call, duplicated, eval, evalq, Filter,
##     Find, get, grep, grepl, intersect, is.unsorted, lapply,
##     lengths, Map, mapply, match, mget, order, paste, pmax,
##     pmax.int, pmin, pmin.int, Position, rank, rbind, Reduce,
##     rowMeans, rownames, rowSums, sapply, setdiff, sort, table,
##     tapply, union, unique, unsplit, which, which.max, which.min
## Loading required package: S4Vectors
## 
## Attaching package: 'S4Vectors'
## The following object is masked from 'package:base':
## 
##     expand.grid
## Loading required package: IRanges
## Loading required package: GenomeInfoDb
target.regions.gr = with(target.regions, GRanges(chr, IRanges(start, end), id=gene, strand = strand))
head(target.regions.gr)
## GRanges object with 6 ranges and 1 metadata column:
##       seqnames               ranges strand |       id
##          <Rle>            <IRanges>  <Rle> | <factor>
##   [1]    chr15 [54711402, 54746402]      + |      Nov
##   [2]    chr12 [86386628, 86470131]      + |    Esrrb
##   [3]    chr16 [23988107, 24023107]      - |     Bcl6
##   [4]     chr7 [30636029, 30649817]      - |     Etv2
##   [5]    chr11 [84526160, 84560042]      - |     Lhx1
##   [6]    chr10 [57451918, 57485851]      + |     Hsf2
##   -------
##   seqinfo: 22 sequences from an unspecified genome; no seqlengths
mouse_enhancer_mESC.gr = with(mouse_enhancer_mESC, GRanges(chr, IRanges(start, end)))
overlap = mergeByOverlaps(mouse_enhancer_mESC.gr, target.regions.gr)
length(overlap$id)
## [1] 27
head(overlap)
## DataFrame with 6 rows and 3 columns
##     mouse_enhancer_mESC.gr          target.regions.gr       id
##                  <GRanges>                  <GRanges> <factor>
## 1   chr3:34645278-34647278   chr3:34638674-34650524:+     Sox2
## 2   chr6:64693906-64695906   chr6:64694741-64729741:+    Atoh1
## 3 chr6:122691182-122693182 chr6:122673146-122708146:+    Nanog
## 4 chr6:122692682-122694682 chr6:122673146-122708146:+    Nanog
## 5   chr8:12389800-12391800   chr8:12361374-12396374:+     Sox1
## 6   chr8:72309501-72311501   chr8:72310260-72319553:+     Klf2
overlap$id
##  [1] Sox2   Atoh1  Nanog  Nanog  Sox1   Klf2   Klf2   Esrrb  Esrrb  Esrrb 
## [11] Esrrb  Esrrb  Esrrb  Esrrb  Esrrb  Esrrb  Klf5   Klf5   Klf5   Klf5  
## [21] Bcl6   Spdef  Spdef  Spdef  Spdef  Pou5f1 Gata1 
## 24 Levels: Nov Esrrb Bcl6 Etv2 Lhx1 Hsf2 Sox2 Isl2 Aes Hey2 Nobox ... Nanog
#sapply(overlap, width)

Designing guides.

library(Biostrings)
## Loading required package: XVector
## 
## Attaching package: 'Biostrings'
## The following object is masked from 'package:base':
## 
##     strsplit
library(BSgenome.Mmusculus.UCSC.mm10)
## Loading required package: BSgenome
## Loading required package: rtracklayer
## Warning: package 'rtracklayer' was built under R version 3.4.2
mm10 = BSgenome.Mmusculus.UCSC.mm10
target.seqs = getSeq(mm10, target.regions.gr)
head(target.seqs)
##   A DNAStringSet instance of length 6
##     width seq
## [1] 35001 CCAAAAACCCATAGATGGGAGGTCATATGTT...CAACAACCAGACTGGCATTTGCATGGGTAAT
## [2] 83504 GGTATGGGAGTGACCCCATTAATAAAGGCGT...CCTCTCACCTCACTTAGAACTGACTCCCGCG
## [3] 35001 AGTTGTTGTGCAGCAATTCTTCTTCCTTTAC...TGGGTTGCGCGGCCTGGGAGGGCGGACCGCG
## [4] 13789 GCGGGGAGGCATTAGCTGGGATGAAGGCGCG...AGGAAGGACAGGGGAACACCAAGATGCAGGG
## [5] 33883 CATGTCTGCCTTCAATTTTGTTACACACATT...CGGGCCTCCGGTTTCTCCCGCCCCCATCAGG
## [6] 33934 TATACAGACACTAAGAGAACACAAATTCCAG...TGCTTCAGGTTTTGATAAAACTGTCCTTAAA
library(seqinr);
## 
## Attaching package: 'seqinr'
## The following object is masked from 'package:Biostrings':
## 
##     translate
wanted_seqs = list(genes = target.regions$gene, 
                   seqs = sapply(target.seqs, toString), 
                   chr = target.regions$chr,
                   start = target.regions$start, 
                   end = target.regions$end, 
                   strand = target.regions$strand)
write_seqs <- function(seqs, gene_names, chrom, start_pos, end_pos, strand, filename){
    stopifnot(dim(seqs)[1] == length(gene_names))
    write.fasta(file.out = filename, sequences = seqs[1], names = paste0(gene_names[1], "\t", chrom[1], "\t", start_pos[1], "\t", end_pos[1], "\t", strand[1]), open = "w", nbchar = 80, as.string = TRUE)
    if(length(gene_names) > 1){
        for(i in 2:length(gene_names)){
            write.fasta(file.out = filename, sequences = seqs[i], names = paste0(gene_names[i], "\t", chrom[i], "\t", start_pos[i], "\t", end_pos[i], "\t", strand[i]), open = "a", nbchar = 80, as.string = TRUE)
        }
  }
}
write_seqs(wanted_seqs$seqs, wanted_seqs$genes, wanted_seqs$chr, round(wanted_seqs$start), round(wanted_seqs$end), wanted_seqs$strand, "tiling_screen_promoters.fa")
write.table(wanted_seqs$genes, file = "genes.txt", sep = "\n", col.names = FALSE, row.names = FALSE, quote = FALSE)
~/sgRNA/sgRNAdesign/propose_sgRNAs -i tiling_screen_promoters.fa -V -R -T -c ~/sgRNA/Meng/guide\ design/enzyme_cutting_seqs.txt -o tiling_guides.fa
while read gene; do
n_lines="$(grep ${gene} tiling_guides.txt | wc -l)";
printf "%s\t%s\n" "${gene}" "${n_lines}";
done < genes.txt

wc -l tiling_guides.fa
head tiling_guides.fa
## PAM = NGG
## number of seqs read in = 24
## names = 
## Nov  chr15   54711402    54746402    +   
## Esrrb    chr12   86386628    86470131    +   
## Bcl6 chr16   23988107    24023107    -   
## Etv2 chr7    30636029    30649817    -   
## Lhx1 chr11   84526160    84560042    -   
## Hsf2 chr10   57451918    57485851    +   
## Sox2 chr3    34638674    34650524    +   
## Isl2 chr9    55536690    55541690    +   
## Aes  chr10   81555024    81560024    +   
## Hey2 chr10   30842291    30877291    -   
## Nobox    chr6    43309052    43344052    -   
## Sox1 chr8    12361374    12396374    +   
## Spdef    chr17   27728456    27750732    -   
## Pou5f1   chr17   35471552    35506552    +   
## Mlxip    chr5    123375492   123395282   +   
## Atoh1    chr6    64694741    64729741    +   
## Gata1    chrX    7967312 8002312 -   
## Lmx1a    chr1    167655065   167690065   +   
## Klf5 chr14   99264445    99299445    +   
## Gata4    chr14   63245265    63306679    -   
## Klf2 chr8    72310260    72319553    +   
## Tfcp2l1  chr1    118612678   118628486   +   
## Klf4 chr4    55531738    55558265    -   
## Nanog    chr6    122673146   122708146   +   
## proposing guides
## seq 1
## seq 2
## seq 3
## seq 4
## seq 5
## seq 6
## seq 7
## seq 8
## seq 9
## seq 10
## seq 11
## seq 12
## seq 13
## seq 14
## seq 15
## seq 16
## seq 17
## seq 18
## seq 19
## seq 20
## seq 21
## seq 22
## seq 23
## seq 24
## # possible sgRNAs = 89999
## removing sgRNAs with constant trinucleotides
## # possible sgRNAs after removing trinucleotides = 24580
## removing sgRNAs with the specified enzyme cutting sequences
## enzyme cutting seqs = 
## CCANNNNNNTGG
## GCTNAGC
## CTCGAG
## # possible sgRNAs after removing cutting sites = 24259
## removing guides based on GC content
## # possible sgRNAs after removing GC rich and poor guides = 24247
## Nov       674
## Esrrb        1266
## Bcl6      835
## Etv2      557
## Lhx1     1019
## Hsf2      743
## Sox2      289
## Isl2      189
## Aes       200
## Hey2      740
## Nobox         813
## Sox1     1049
## Spdef        1065
## Pou5f1        950
## Mlxip         642
## Atoh1         854
## Gata1        1008
## Lmx1a        1142
## Klf5      928
## Gata4        1116
## Klf2      320
## Tfcp2l1       563
## Klf4      823
## Nanog        1150
##    48494 tiling_guides.fa
## > Nov    chr15   54711679    +
## ATGAGAGCCATAGAATGGAG
## > Nov    chr15   54711693    +
## ATGGAGAGGAATTCTGTGAA
## > Nov    chr15   54711752    +
## TGATTGCCACATGAGATACA
## > Nov    chr15   54711781    +
## AATTCTGGCATTGATGAGAA
## > Nov    chr15   54711836    +
## TATTGCCATCTGATAGTTGC